| Sequence ID | >WENV170576152 |
| Genome ID | FPKX01000064 |
| Phylum/Class | [FPKX] hydrothermal vent metagenome; water |
| Species | |
| Start position on genome | 821 |
| End posion on genome | 735 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
gtaccaattt |
| tRNA gene sequence |
GCCCGGGTGGTGGAATGGTAGACACAGGGGACTTAAAATCCCCCGGTCATTGTGACCGTG |
| Downstream region at tRNA end position |
tttaaagcga |
| Secondary structure (Cloverleaf model) | >WENV170576152 Leu TAA
t ACCA tttaaagcga
G + T
C - G
C - G
C - G
G - C
G - C
G + T T G
T C G G C C A
T A A G | | | | | A
G G G T G G C C G G C
G | | | T T
T A C A C
A G A CGGTCATTGTGACCGT
G - C
G - C
G - C
G - C
A - T
C A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |