Sequence ID | >WENV170577088 |
Genome ID | FRDC01003082 |
Search identical group | |
Phylum/Class | [FRDC] freshwater metagenome; water |
Species | |
Start position on genome | 285 |
End posion on genome | 361 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aaattgagat |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGCCACCCTCCGAAGGTGGAGGCCACACGTTCGAA |
Downstream region at tRNA end position |
acctccctag |
Secondary structure (Cloverleaf model) | >WENV170577088 Arg CCG t GCCA acctccctag G - C C - G A - T C - G C - G C - G G - C T A T T G T G C A C G A A | | | | | G T C T C G A C A C G C G | | | | T T G G A G C A T A G AGGCC C - G C - G A - T C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |