Sequence ID | >WENV170577803 |
Genome ID | FSSH01001365 |
Search identical group | |
Phylum/Class | [FSSH] freshwater metagenome; drinking water |
Species | |
Start position on genome | 4756 |
End posion on genome | 4840 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaacccggat |
tRNA gene sequence |
GGGGGAATGTCCCGAGTGGCAAAGGGGGCGGACTGTAAATCCGCTGGCTTAGCCTTCGCA |
Downstream region at tRNA end position |
tctgattttt |
Secondary structure (Cloverleaf model) | >WENV170577803 Tyr GTA t ACCA tctgattttt G - C G - C G - C G - C G - C A - T A - T T G T C G T C C A G A G G | | | | | G T C C C T G C A G G C G | | + T T G A G G G C A A G TGGCTTAGCCTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |