Sequence ID | >WENV170579684 |
Genome ID | FUFK010040363 |
Search identical group | |
Phylum/Class | [FUFK] metagenome; unknown |
Species | |
Start position on genome | 2639 |
End posion on genome | 2549 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttgcacctat |
tRNA gene sequence |
GGAGACGTGGCAGAGCGGTTGAATGCACCGGTCTTGAAAACCGGCAAGGGTTCATAGCCC |
Downstream region at tRNA end position |
aatttgttct |
Secondary structure (Cloverleaf model) | >WENV170579684 Ser TGA t GCCA aatttgttct G - C G - C A - T G - C A - T C - G G - C T A T C T C T C A C G A G | | | | | G G G A C G G A G A G C G | | | T T T A T G C T G A A CAAGGGTTCATAGCCCTTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |