Sequence ID | >WENV170583407 |
Genome ID | FUFK010136605 |
Search identical group | |
Phylum/Class | [FUFK] metagenome; unknown |
Species | |
Start position on genome | 245 |
End posion on genome | 171 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caattccccT |
tRNA gene sequence |
GGGGGTGTAGCAATCTGGTGAATGCACCAAACTCATAATTTGGCTAAGGCGAGTTCGATC |
Downstream region at tRNA end position |
ttcatttgtt |
Secondary structure (Cloverleaf model) | >WENV170583407 Met CAT T ATta ttcatttgtt G - C G - C G - C G - C G - C T - A G - C C T T C G C T C A T C T A | | | | | G G A A C G G C G A G C G | | | T T T A T G C G A A CTAAG C - G C - G A - T A - T A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |