Sequence ID | >WENV170593102 |
Genome ID | FUFK010844263 |
Search identical group | |
Phylum/Class | [FUFK] metagenome; unknown |
Species | |
Start position on genome | 128 |
End posion on genome | 54 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
taatcaaatg |
tRNA gene sequence |
GTGGTTGTAGCTCAGCTGGTTAGAGCGCCGGATTGTGGTTCCGGAGGTCGCCGGTTCGAA |
Downstream region at tRNA end position |
acaaagcttc |
Secondary structure (Cloverleaf model) | >WENV170593102 His GTG g CCtc acaaagcttc G - C T - A G - C G - C T T T T G - C A A T T G G C C A C G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |