Sequence ID | >WENV170597799 |
Genome ID | FUWD010014743 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 71 |
End posion on genome | 146 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaagtatatg |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCCCCGGATTGTGATTCCGGTTGTCGCGGGTTCGAGC |
Downstream region at tRNA end position |
tttactgctt |
Secondary structure (Cloverleaf model) | >WENV170597799 His GTG g CCCA tttactgctt G - C C - G G - C G + T G - C A - T A - T C G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A C TTGTC C - G C - G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |