Sequence ID | >WENV170598845 |
Genome ID | FUWD010051876 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 214 |
End posion on genome | 127 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ggaatgcaac |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCACGCTTGGAAAGCGTGTTGGGTGAAAGCCCTC |
Downstream region at tRNA end position |
ttagaaaatt |
Secondary structure (Cloverleaf model) | >WENV170598845 Ser GGA c GCGA ttagaaaatt G - C G - C A - T G - C G - C A - T T - A T A T T C C C C A T G A C | | | | | G G T C C G A G G G G C G | | | T T C T G G C C T A G TTGGGTGAAAGCCCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |