Sequence ID | >WENV170600574 |
Genome ID | FUWD010133295 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 146 |
End posion on genome | 221 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aacaagaccc |
tRNA gene sequence |
GGGGATTTAGCTCAGTTGGTAGAGCACCTGCTTTGCAAGCAGGGGGTCAGGGGTTCGACC |
Downstream region at tRNA end position |
ttcgtcctct |
Secondary structure (Cloverleaf model) | >WENV170600574 Ala TGC c ACAA ttcgtcctct G - C G - C G + T G - C A - T T - A T - A C C T T C C C C A T G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |