| Sequence ID | >WENV170602034 |
| Genome ID | FUWD010211107 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 76 |
| End posion on genome | 3 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
ctcaccgcat |
| tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCCCCAGCCTTCCAAGCTGGCCATGCCGGTTCGATCCC |
| Downstream region at tRNA end position |
agnnnnnnnn |
| Secondary structure (Cloverleaf model) | >WENV170602034 Gly TCC
t TCCA agnnnnnnnn
G - C
C - G
G - C
G - C
G - C
T - A
G - C C T
T T G G C C A
A A A + | | | | G
T C T C G G C C G G C
G | | | | T T
G G A G C
T A C CCAT
C - G
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |