Sequence ID | >WENV170604966 |
Genome ID | FUWD010438541 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 416 |
End posion on genome | 500 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
taaaaattaa |
tRNA gene sequence |
GGAGAGGTCGGATAATGGTATTCCACCAGTTTGCTAAACTGGCGTCCGCAAGGACTTGCG |
Downstream region at tRNA end position |
tactcagcgt |
Secondary structure (Cloverleaf model) | >WENV170604966 Ser GCT a GCCA tactcagcgt G - C G - C A - T G - C A - T G - C G - C C G T C G C C C A A A C | | | | | G T T A G G G C G G G C G | | | T T G T T C C T A A CGTCCGCAAGGACTT C - G C - G A - T G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |