Sequence ID | >WENV170605897 |
Genome ID | FUWD010562110 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 4 |
End posion on genome | 80 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
nnnnnnntat |
tRNA gene sequence |
AGGACTATAGCTCAGTTGGTTAGAGCGCTACCTTGACATGGTAGAGGTCCCCAGTTCGAA |
Downstream region at tRNA end position |
tttcctcttc |
Secondary structure (Cloverleaf model) | >WENV170605897 Val GAC t ACCA tttcctcttc A - T G - C G - C A - T C - G T - A A - T T A T G G G T C A T G A A | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |