Sequence ID | >WENV170606631 |
Genome ID | FUWD010696229 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 259 |
End posion on genome | 182 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
cccgtactaT |
tRNA gene sequence |
GGGGCGTAAGGTAAGCCGGTTGCATCCGATACTCTTATAAGGTATTCATAGGTAGGTTCG |
Downstream region at tRNA end position |
cttttacatg |
Secondary structure (Cloverleaf model) | >WENV170606631 Ile TAT T ATtc cttttacatg G + T G - C G - C G - C C - G G - C T - A T C A C A T C C A C C G A A | | | | | G G A T G G G T A G G C G | | T T T A T C C T G C G TCATAG A - T T - A A - T C - G T + G C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |