| Sequence ID | >WENV170608043 |
| Genome ID | FUWD010886503 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 530 |
| End posion on genome | 613 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
cagtctcaca |
| tRNA gene sequence |
GGAAGGTTGCGGCGAATGGTAAGCCACAGGTTTGCTAAACCTGCGTCCGAAAGGGCATGT |
| Downstream region at tRNA end position |
ttggtctaaa |
| Secondary structure (Cloverleaf model) | >WENV170608043 Ser GCT
a GCtt ttggtctaaa
G - C
G - C
A - T
A - T
G - C
G - C
T - A T C
T C A C C C A
A A G G | | | | | G
T C G G C G T G G G C
G | T T
G A G C C
T A A CGTCCGAAAGGGCAT
C - G
A - T
G - C
G - C
T - A
T A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |