Sequence ID | >WENV170608250 |
Genome ID | FUWD010908924 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 439 |
End posion on genome | 522 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gtaaactttg |
tRNA gene sequence |
ATCAGAGTGGTGGAAATGGTAGACACGCCAGACTTAGGTTCTGGTTTTTTAAGAAAAATA |
Downstream region at tRNA end position |
ttctaaaacg |
Secondary structure (Cloverleaf model) | >WENV170608250 Leu TAG g Aatt ttctaaaacg A - T T - A C - G A - T G - C A - T G + T T A T T T C C C A A A A G | | | | A T G G T G A T G G G C G | | | T T G A C A C T A G G TTTTTTAAGAAAAAT C - G C - G A - T G - C A - T C T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |