Sequence ID | >WENV170611483 |
Genome ID | FUWD012328161 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 230 |
End posion on genome | 305 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cagattatat |
tRNA gene sequence |
CGCTGCGTAGAGTAACGGCTAACTCGTCGGTCTCATAATCCGAAGATATTGGGTTCAACT |
Downstream region at tRNA end position |
aataaataat |
Secondary structure (Cloverleaf model) | >WENV170611483 Met CAT t ACCA aataaataat C T G - C C - G T - A G - C C - G G - C T C T A A C C C A C A A A | | | | | A G T G A G T T G G G C G | | | | T T C A C T C T A G AGATA T - A C - G G - C G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |