Sequence ID | >WENV170611565 |
Genome ID | FUWD012349439 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 10 |
End posion on genome | 84 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
naacatatat |
tRNA gene sequence |
TGCGCAGTGGTAGAGGTGGTTTCTCACGATGGTCTCATAAGCCATAGACAACAGTTCGAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170611565 Met CAT t ACnn nnnnnnnnnn T - A G - C C - G G - C C - G A - T G - C T G T T T G T C A T G G A G | | | | | G G G A T G A A C A G C G + | | T T T T C A C T T C G AGAC A - T T - A G - C G - C T + G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |