Sequence ID | >WENV170611664 |
Genome ID | FUWD012369556 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 79 |
End posion on genome | 154 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aattaaattt |
tRNA gene sequence |
TCCGATGTAGCTCAGTTGGTAGAGTGAGTGGCTGTTAACCACTATGTCCTTGGTTCGAGT |
Downstream region at tRNA end position |
attttaaaga |
Secondary structure (Cloverleaf model) | >WENV170611664 Asn GTT t GCCA attttaaaga T - A C - G C - G G - C A - T T + G G + T T G T G A A C C A T G A A | | | | | G T C T C G C T T G G C G | | | + T T G G A G T T A G ATGTC A - T G - C T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |