| Sequence ID | >WENV170611994 |
| Genome ID | FUWD012478378 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 141 |
| End posion on genome | 54 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
aaataattaa |
| tRNA gene sequence |
GCCGAAGTGGCGGAATTGGCAGACGCGCATGGTTTAGGACCATGTCCCGTTTAACGGGAT |
| Downstream region at tRNA end position |
gttaacaaaa |
| Secondary structure (Cloverleaf model) | >WENV170611994 Leu TAG
a ACTA gttaacaaaa
G - C
C - G
C - G
G - C
A - T
A - T
G - C T C
T C C C T C A
T A A G | | | | | A
T G G C G G G G A G C
G | | | T T
G A C G C
C A G G TCCCGTTTAACGGGAT
C - G
A - T
T - A
G - C
G - C
T A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |