| Sequence ID | >WENV170612539 |
| Genome ID | FUWD012631304 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 195 |
| End posion on genome | 119 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
ggagtattaa |
| tRNA gene sequence |
GGGCGATTAGCTCAGCTGGCTAGAGCATCACATTGACATTGTGGAGGTCACAGGTTCAAG |
| Downstream region at tRNA end position |
gtgaaacaat |
| Secondary structure (Cloverleaf model) | >WENV170612539 Val GAC
a ACCA gtgaaacaat
G - C
G - C
G - C
C - G
G - C
A - T
T - A T G
T T G C C C A
C G A A | | | | A
T C T C G A C A G G C
G | | | | T T
G G A G C
C T A A AGGTC
T + G
C - G
A - T
C - G
A - T
T T
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |