Sequence ID | >WENV170612821 |
Genome ID | FUWD012696738 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 148 |
End posion on genome | 222 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tatttccaat |
tRNA gene sequence |
GCGGGAGTAATTCAGTGGTAGAATGCCAGCTTCCCATGCTGGACGTCGGGGGTTCGAGTC |
Downstream region at tRNA end position |
ctttaacggt |
Secondary structure (Cloverleaf model) | >WENV170612821 Gly CCC t TCCA ctttaacggt G - C C - G G - C G - C G - C A - T G - C T G T T C C C C A G A A + | | | | G T C T T A G G G G G C G | | | | T T G G A A T T A G ACGTC C - G C - G A - T G - C C - G T T T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |