| Sequence ID | >WENV170614418 |
| Genome ID | FUWD012832932 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 21691 |
| End posion on genome | 21603 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
aactctaaaT |
| tRNA gene sequence |
GGAGAGGTGGCCGAGTGGACGATGGCGCAGCACTGGAAATGCTGTATAGGGGCAACTCTA |
| Downstream region at tRNA end position |
ttcatcaaaa |
| Secondary structure (Cloverleaf model) | >WENV170614418 Ser GGA
T GTag ttcatcaaaa
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C T C C C A
T G A G | | | | | G
G G C C G G A G G G C
G + | | | T T
A T G G C
C G A G TATAGGGGCAACTCTATC
C - G
A - T
G - C
C - G
A - T
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |