Sequence ID | >WENV170614661 |
Genome ID | FUWD012839040 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 736 |
End posion on genome | 820 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tggttatttT |
tRNA gene sequence |
GCTGAGTTGTCCGAGTGGTCTAAGGAGGACGACTTAAGATCGTCTGTGCTACGCACGCGC |
Downstream region at tRNA end position |
gcactcatag |
Secondary structure (Cloverleaf model) | >WENV170614661 Leu TAA T ATtc gcactcatag G - C C - G T - A G - C A - T G - C T T T A T C G C C C A T G A G | | | | | A G G C C T G C G G G C G | | | T T T A G G A C T A G TGTGCTACGCACGC G - C A - T C - G G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |