| Sequence ID | >WENV170615542 |
| Genome ID | FUWD012860472 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 696 |
| End posion on genome | 783 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
actcttccgc |
| tRNA gene sequence |
GGAGGCCTGTCCGAGCGGCCGATGGAGCTGGTCTTGAAAACCAGTGGGCAGAAATGTCTC |
| Downstream region at tRNA end position |
tcgaagctta |
| Secondary structure (Cloverleaf model) | >WENV170615542 Ser TGA
c GCCA tcgaagctta
G - C
G - C
A - T
G - C
G - C
C - G
C - G T A
T C A C C C A
C G A G | | | | | G
G G C C T G T G G G C
G + | | | T T
C T G G A
C G A G TGGGCAGAAATGTCTC
C - G
T - A
G - C
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |