Sequence ID | >WENV170615974 |
Genome ID | FUWD012873317 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 113 |
End posion on genome | 38 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ataatctatt |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCTTGCCTTGCACGCAAGAGGTCGGGAGTTCGATC |
Downstream region at tRNA end position |
cttaatctaa |
Secondary structure (Cloverleaf model) | >WENV170615974 Ala TGC t ACCA cttaatctaa G - C G - C G + T G - C C - G C - G A - T C T T C C C T C A C G A A | | | | | G T C T C G G G G A G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |