| Sequence ID | >WENV170617182 |
| Genome ID | FUWD012916744 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 148 |
| End posion on genome | 73 |
| Amino Acid | Thr |
| Anticodon | AGT |
| Upstream region at tRNA start position |
tatcaacgaG |
| tRNA gene sequence |
GGCGCCATGGCTTAGTTGGTTAAAGCGCCTGTTTAGTAAACAGGAGATCCCGAGTTCGAA |
| Downstream region at tRNA end position |
aaaatcatat |
| Secondary structure (Cloverleaf model) | >WENV170617182 Thr AGT
G TAgt aaaatcatat
G - C
G - C
C - G
G + T
C - G
C - G
A - T T A
T G G C T C A
T G A G | | | | | G
T T T C G C C G A G C
G | | | | T T
G A A G C
T T A G AGATC
C - G
C - G
T - A
G - C
T - A
T A
T A
A G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |