| Sequence ID | >WENV170617459 |
| Genome ID | FUWD012926983 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 2748 |
| End posion on genome | 2677 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
ttaatgtccc |
| tRNA gene sequence |
GGCTTGATGGTCTAGGGGTATGATTCGTGCTTCGGGTGCACGAGGTCCCGAGTTCAATTC |
| Downstream region at tRNA end position |
taatcctttt |
| Secondary structure (Cloverleaf model) | >WENV170617459 Pro CGG
c Caac taatcctttt
G - C
G - C
C - G
T - A
T - A
G - C
A - T T T
T G G C T C A
G A G | | | | | A
G T C T G C C G A G C
G | | + T T
G T G A T
T A T AGGTC
C - G
G - C
T - A
G - C
C - G
T T
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |