Sequence ID | >WENV170621973 |
Genome ID | FUWD013082315 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 1820 |
End posion on genome | 1747 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gtccgcccat |
tRNA gene sequence |
TCCAAGATCATTCAACGGTAGGATGGGTGGCTGTTAACCACCTAATCTTGGTTCGAATCC |
Downstream region at tRNA end position |
tagatttgtc |
Secondary structure (Cloverleaf model) | >WENV170621973 Asn GTT t GCAA tagatttgtc T - A C - G C - G A - T A - T G - C A - T T A T G A A C C A A A C | | | | | G C C T T A C T T G G C G | + | | T T G G G A T T A G TAAT G - C G - C T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |