Sequence ID | >WENV170622239 |
Genome ID | FUWD013093762 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 977 |
End posion on genome | 902 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
aatagggatt |
tRNA gene sequence |
GCCGATGTAGCTCAGTTGGTAGAGCACCTCCATGGTAAGGAGTAGGTCCTCGGTTCGAAT |
Downstream region at tRNA end position |
ggaaaagaaa |
Secondary structure (Cloverleaf model) | >WENV170622239 Thr GGT t TCAA ggaaaagaaa G - C C - G C - G G - C A - T T - A G - C T A T G A G C C A T G A A | | | | | G T C T C G C T C G G C G | | | | T T G G A G C T A A AGGTC C T C - G T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |