Sequence ID | >WENV170622575 |
Genome ID | FUWD013110676 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 510 |
End posion on genome | 435 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aaaaagcaat |
tRNA gene sequence |
GGTACCTTAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCCCTGGTTCGATT |
Downstream region at tRNA end position |
aagtctctat |
Secondary structure (Cloverleaf model) | >WENV170622575 Phe GAA t ACAA aagtctctat G - C G - C T - A A - T C - G C - G T - A T T T G G T C C A T G A A | | | | G T C T C G C C T G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |