Sequence ID | >WENV170622830 |
Genome ID | FUWD013122743 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 454 |
End posion on genome | 379 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tttatcataa |
tRNA gene sequence |
GCGGGCATAGCTCAGTTGGTAGAGTACAAGCTTCCCAAGCTTGGTGTCGCGGGTTCGAAC |
Downstream region at tRNA end position |
tgttttagtt |
Secondary structure (Cloverleaf model) | >WENV170622830 Gly CCC a TCTA tgttttagtt G - C C - G G - C G - C G - C C - G A - T C A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T A A GTGTC C - G A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |