Sequence ID | >WENV170623052 |
Genome ID | FUWD013134386 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 191 |
End posion on genome | 117 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atttcaagag |
tRNA gene sequence |
GGGCCCATAGCTCAATTGGTTAGAGCGCCGGACTCATAATCCGTCGGTTCGGGGTTCGAG |
Downstream region at tRNA end position |
aaagaggtca |
Secondary structure (Cloverleaf model) | >WENV170623052 Met CAT g ACtt aaagaggtca G - C G - C G - C C - G C - G C - G A - T T G T G T C C C A T A A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T T A G CGGTT C T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |