| Sequence ID | >WENV170623409 |
| Genome ID | FUWD013150242 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 77 |
| End posion on genome | 2 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
aaattactag |
| tRNA gene sequence |
GTGGCTGTAGCTCAGTTGGTTAGAGCGTCCCCCTGTGGAGGGGAAGGTCGCGAGTTCGAA |
| Downstream region at tRNA end position |
nnnnnnnnnn |
| Secondary structure (Cloverleaf model) | >WENV170623409 His GTG
g CCAa nnnnnnnnnn
G - C
T - A
G - C
G - C
C - G
T - A
G + T T A
T T G C T C A
T G A A + | | | | G
T C T C G G C G A G C
G | | | | T T
G G A G C
T T A G AGGTC
T - A
C - G
C - G
C - G
C - G
C A
T G
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |