| Sequence ID | >WENV170624647 |
| Genome ID | FUWD013184447 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 461 |
| End posion on genome | 386 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
gcgtaactaa |
| tRNA gene sequence |
GCGCCCGTAGCTCAACGGATAGAGCATCTGACTACGGATCAGAAGGTTGGGGGTTCGAAT |
| Downstream region at tRNA end position |
ctgtgatctc |
| Secondary structure (Cloverleaf model) | >WENV170624647 Arg ACG
a GCCA ctgtgatctc
G + T
C - G
G - C
C - G
C - G
C - G
G - C T A
T C T C C C A
C A A A | + | | | G
G C T C G G G G G G C
G | | | | T T
A G A G C
T A A AGGTT
T - A
C - G
T - A
G - C
A - T
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |