Sequence ID | >WENV170624747 |
Genome ID | FUWD013186080 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 613 |
End posion on genome | 538 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cttgggacaa |
tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGTAGAGCGTCTCACTCGTAATGAGAAGGTCGAGAGTTCGATT |
Downstream region at tRNA end position |
gtcaaggctg |
Secondary structure (Cloverleaf model) | >WENV170624747 Thr CGT a CCCA gtcaaggctg G - C C - G C - G G + T C - G C - G T - A T T T C T C T C A T G A A | | | | | G T C T C G G A G A G C G | | | | T T G G A G C T A G AGGTC T - A C - G T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |