| Sequence ID | >WENV170625320 |
| Genome ID | FUWD013195939 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 871 |
| End posion on genome | 796 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
aattataatt |
| tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGCAGAGCATCTGATTTCCAATCAGAATGTCGTCGGTTCGAAC |
| Downstream region at tRNA end position |
accgtcccct |
| Secondary structure (Cloverleaf model) | >WENV170625320 Gly TCC
t TCCA accgtcccct
G - C
C - G
G - C
G - C
G - C
T - A
G - C C A
T T A G C C A
T G A A + | | | | G
T C T C G G T C G G C
G | | | | T T
G G A G C
C A A ATGTC
T - A
C - G
T - A
G - C
A - T
T A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |