Sequence ID | >WENV170626980 |
Genome ID | FUWD013230617 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 2611 |
End posion on genome | 2538 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aggttcccta |
tRNA gene sequence |
GCCCCCATAGCTCAGGGGATAGAGCGTCTGCCTCCGGAGCAGAAGGCCGCAGGTTCGAAT |
Downstream region at tRNA end position |
ctagattttc |
Secondary structure (Cloverleaf model) | >WENV170626980 Arg CCG a ACgc ctagattttc G - C C - G C - G C - G C - G C - G A - T T A T C G T C C A G G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A G AGGCC T - A C - G T - A G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |