Sequence ID | >WENV170629458 |
Genome ID | FUWD013270939 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 91 |
End posion on genome | 3 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atgtccgggc |
tRNA gene sequence |
GGGGGCATGGCGGAATCGGTAGACGCACGCGACTTAAAATCGCTTGGGCCGAAAGGCCTG |
Downstream region at tRNA end position |
ccnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170629458 Leu TAA c ACCA ccnnnnnnnn G - C G - C G - C G - C G - C C - G A - T T G T C C C C C A T A A G | | | | | A C G G C G G G G G G C G | | | T T G A C G C T A G A TGGGCCGAAAGGCCTGT C T G - C C - G G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |