Sequence ID | >WENV170629469 |
Genome ID | FUWD013271102 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 1287 |
End posion on genome | 1216 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
taaagtttac |
tRNA gene sequence |
GGGACTGTCGCCTAAAGGTAAAGGCCCTCTGCTTATAACGGAGTGATCTGGGTTCAAGTC |
Downstream region at tRNA end position |
ctcctttagc |
Secondary structure (Cloverleaf model) | >WENV170629469 Ile TAT c Attg ctcctttagc G + T G - C G - C A - T C - G T - A G - C T G T G A C C C A A A A C | | | | | A G T C C G C T G G G C G | | | | T T T A G G C A A C TGAT C - G T - A C - G T + G G - C C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |