Sequence ID | >WENV170630173 |
Genome ID | FUWD013297672 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 377 |
End posion on genome | 300 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gactacatta |
tRNA gene sequence |
GCCTGTGTAGCTCACGTTGGCTAGAGCAGCGGTTTTGTAAACCGCAGGTCGGTGGTTCGA |
Downstream region at tRNA end position |
taaggaagaa |
Secondary structure (Cloverleaf model) | >WENV170630173 Thr TGT a TCAA taaggaagaa G - C C - G C - G T - A G - C T + G G + T T T T C C A C C A T G C A A | | | | | G T C T C G G G T G G C G | | | | T T G G A G C C T A A AGGTC G - C C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |