Sequence ID | >WENV170630442 |
Genome ID | FUWD013308442 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 701 |
End posion on genome | 772 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
aagaacaatt |
tRNA gene sequence |
GCGAGTGTGGTATAACGGTTATTATATCTCCTTCCCAAGGAGATGACGGCGGTTCGACTC |
Downstream region at tRNA end position |
ttaagggccg |
Secondary structure (Cloverleaf model) | >WENV170630442 Gly CCC t Tttt ttaagggccg G - C C - G G - C A - T G - C T - A G - C T C T T C G C C A C A A G + | | | | G G T A T G G G C G G C G | | + T T T T T A T T A A TGAC T - A C - G T - A C - G C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |