Sequence ID | >WENV170631020 |
Genome ID | FUWD013335176 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 388 |
End posion on genome | 462 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
aagttactac |
tRNA gene sequence |
GCCCCTGTAGCTCAACGGATAGAGTGTATCCTTGCGGAGGATAAGACGCAGGTTCGATTC |
Downstream region at tRNA end position |
ttaatcttat |
Secondary structure (Cloverleaf model) | >WENV170631020 Arg GCG c ACCA ttaatcttat G + T C - G C - G C - G C - G T - A G - C T T T T G T C C A C A A A + | | | | G G C T C G G C A G G C G | | | + T T A G A G T T A G AGAC T - A A - T T - A C - G C - G T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |