Sequence ID | >WENV170632278 |
Genome ID | FUWD013380292 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 519 |
End posion on genome | 445 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gaattgttga |
tRNA gene sequence |
GCGGGCGTAATTCAGGGGTAGAATGTCAGCTTCCCAAGCTGAATGTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
atctttttgg |
Secondary structure (Cloverleaf model) | >WENV170632278 Gly CCC a TCCA atctttttgg G - C C - G G - C G - C G - C C - G G - C T A T T A C C C A G A A + | | | | G G C T T A G T G G G C G | | | | T T G G A A T T A G ATGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |