| Sequence ID | >WENV170632633 |
| Genome ID | FUWD013385414 |
| Phylum/Class | [FUWD] metagenome; unknown |
| Species | |
| Start position on genome | 740 |
| End posion on genome | 665 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
cttttgagcg |
| tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGTCAGCCTTCCAAGCTGAACGTCGCGGGTTCGAGT |
| Downstream region at tRNA end position |
aaatattagc |
| Secondary structure (Cloverleaf model) | >WENV170632633 Gly TCC
g TCCA aaatattagc
G - C
C - G
G - C
G - C
G - C
A - T
A - T T G
T T G C C C A
T G A A + | | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A G ACGTC
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |