Sequence ID | >WENV170634106 |
Genome ID | FUWD013409935 |
Search identical group | |
Phylum/Class | [FUWD] metagenome; unknown |
Species | |
Start position on genome | 818 |
End posion on genome | 893 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tgggggcatg |
tRNA gene sequence |
GTGTGTATAGCTCAATGGTCAGAGCTCCTGGTTGTGGACTAGGATGATGCGGGTTCGAAT |
Downstream region at tRNA end position |
aggggccctt |
Secondary structure (Cloverleaf model) | >WENV170634106 His GTG g CCGA aggggccctt G - C T - A G - C T - A G - C T - A A - T T A T T G C C C A T A A A + | | | | G G C T C G G C G G G C G | | | | T T T G A G C C A T ATGAT C - G C - G T - A G + T G - C T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |