Sequence ID | >WENV170634343 |
Genome ID | FYBJ01000268 |
Search identical group | |
Phylum/Class | [FYBJ] marine metagenome; marine |
Species | |
Start position on genome | 14479 |
End posion on genome | 14396 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gatctcaaat |
tRNA gene sequence |
GGGGAGATTCCAGAGCGGCCAAATGGGACGGACTGTAACTCCGTTGTCTTTCGACTTCGC |
Downstream region at tRNA end position |
ttttgagaag |
Secondary structure (Cloverleaf model) | >WENV170634343 Tyr GTA t ACat ttttgagaag G - C G - C G - C G - C A - T G - C A - T T A T C G T C C A C G A T | | | | | G G G A C C G C A G G C G | | | T T C A T G G C A A G TGTCTTTCGACTTC A - T C - G G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |