Sequence ID | >WENV170635121 |
Genome ID | JDSF01000045 |
Search identical group | |
Phylum/Class | [JDSF] bioreactor metagenome; continuous culture bioreactor denitrification-DNRA |
Species | |
Start position on genome | 56440 |
End posion on genome | 56353 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cggaattcgc |
tRNA gene sequence |
GGAGAGGTGACCGAGAGGCCGATGGTGCTCGCCTGGAAAGCGGGTGTAGTTAACGCTACC |
Downstream region at tRNA end position |
taatttatca |
Secondary structure (Cloverleaf model) | >WENV170635121 Ser GGA c GCCA taatttatca G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A A G A G | | | | | G G G C C A G G G G G C G + | | | T T C T G G T C G A G TGTAGTTAACGCTACC C - G T + G C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |