Sequence ID | >WENV170635267 |
Genome ID | JDSF01000556 |
Search identical group | |
Phylum/Class | [JDSF] bioreactor metagenome; continuous culture bioreactor denitrification-DNRA |
Species | |
Start position on genome | 2581 |
End posion on genome | 2656 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aaacgttgat |
tRNA gene sequence |
GGCTCGGTAGCTCAGTCGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGGCAGTTCGATT |
Downstream region at tRNA end position |
cttaaattgt |
Secondary structure (Cloverleaf model) | >WENV170635267 Phe GAA t ACCA cttaaattgt G - C G - C C - G T C C - G G - C G - C T T T C C G T C A T G A A | | | | | G C C T C G G G C A G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |