| Sequence ID | >WENV170635445 |
| Genome ID | JDSF01023328 |
| Phylum/Class | [JDSF] bioreactor metagenome; continuous culture bioreactor denitrification-DNRA |
| Species | |
| Start position on genome | 272 |
| End posion on genome | 198 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
accacagcgt |
| tRNA gene sequence |
GGCCCGTTCGTCTATCGGTTAGGACGCCAGGTTTTCAACCTGGAAAGAGGGGTTCGATTC |
| Downstream region at tRNA end position |
cttccccccg |
| Secondary structure (Cloverleaf model) | >WENV170635445 Glu TTC
t GCCA cttccccccg
G + T
G - C
C - G
C - G
C - G
G - C
T - A T T
T T C C C C A
C T A C | | | | | G
G T C T G A G G G G C
G + | | | T T
T G G A C
T A G AAAG
C - G
C - G
A - T
G - C
G - C
T A
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |