Sequence ID | >WENV170643650 |
Genome ID | JMBV01000029 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 862 |
End posion on genome | 778 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttaatctgat |
tRNA gene sequence |
GCCCAGATGGCGGAATTGGTAGACGCGCTGGTCTCAAACACCAGTGGATTCACTTCCATG |
Downstream region at tRNA end position |
gaaaagacaa |
Secondary structure (Cloverleaf model) | >WENV170643650 Leu CAA t ACtc gaaaagacaa G + T C - G C - G C - G A - T G - C A - T C T T C G G C C A T A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G G TGGATTCACTTCCAT C - G T - A G - C G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |